Reply
Fri 21 Jan, 2005 05:19 am
I've developed a new code that I wanted to test out on a few people. Would you mind if I post it here and see whether you can understand what I'm saying?
Here is the coded phrase:
Ugguagugacuugau uauuaguga ugaauugacgaaagaucgacggccaacgau auggag auauuu aaaaaugagugg gccuaauagugaacc ugcuaggauuagaccagc?
This is a prototype code, so it hasn't been perfected completely. It's also a very difficult code to use, since there are a few letters missing from it.
Let me see now: aa, ca, ga, ua, and ac, cc, gc, uc, along with ag, cg, gg, ug and au, cu, gu, uu when the previous combinations are reversed - that makes 16 couplets.
Are each set of couplets related to letters of the alphabet?
Now if I told you that, where would be the fun in cracking the code? Let me tell you that you're certainly thinking on the right track.
Go on. Just a little hint would be nice.
64 combos if you use triplets.
You should probably use one of your codes for the space, as the breaks in the sentence provide clues.
Also, you may wish to cross-post to the Riddles forum.
Four different nitrogen bases are found in DNA. They are adenine (A), cytosine (C), guanine (G) and thymine (T). In RNA, thymine is replaced by uracil (U).
markr wrote:Four different nitrogen bases are found in DNA. They are adenine (A), cytosine (C), guanine (G) and thymine (T). In RNA, thymine is replaced by uracil (U).
Yes, thank you, but I knew that already. My last post was just my way of indirectly saying that both DrewDad and Magus had figured out the basis for my code and that if they applied their knowledge of codons to the code, they would have cracked it.
All that meaning contained in the one word followed by a smiley.
Wolf_ODonnell wrote:markr wrote:Four different nitrogen bases are found in DNA. They are adenine (A), cytosine (C), guanine (G) and thymine (T). In RNA, thymine is replaced by uracil (U).
Yes, thank you, but I knew that already. My last post was just my way of indirectly saying that both DrewDad and Magus had figured out the basis for my code and that if they applied their knowledge of codons to the code, they would have cracked it.
All that meaning contained in the one word followed by a smiley.
So, not only are you into cryptography, but you've got a helluva compression algorithm, too!
Bibliophile the BibleGuru wrote:Is the CODE now solved?
ah, you guys have figured out the basis for the code, but you haven't actually figured out what the messages says now have you?
markr wrote:AUGGCCUAUUAAGAG
I see you've cracked it with that reply. Very well, I think I shall come up with a new code now to replace this one.
Stumble It!
Tweet This
Bookmark on Delicious
Share on Facebook
Share on MySpace