Reply Fri 21 Jan, 2005 05:19 am
I've developed a new code that I wanted to test out on a few people. Would you mind if I post it here and see whether you can understand what I'm saying?

Here is the coded phrase:

Ugguagugacuugau uauuaguga ugaauugacgaaagaucgacggccaacgau auggag auauuu aaaaaugagugg gccuaauagugaacc ugcuaggauuagaccagc?

This is a prototype code, so it hasn't been perfected completely. It's also a very difficult code to use, since there are a few letters missing from it.
  • Topic Stats
  • Top Replies
  • Link to this Topic
Type: Discussion • Score: 1 • Views: 1,136 • Replies: 14
No top replies

 
Bibliophile the BibleGuru
 
  1  
Reply Fri 21 Jan, 2005 07:28 am
Let me see now: aa, ca, ga, ua, and ac, cc, gc, uc, along with ag, cg, gg, ug and au, cu, gu, uu when the previous combinations are reversed - that makes 16 couplets.

Are each set of couplets related to letters of the alphabet?
0 Replies
 
Wolf ODonnell
 
  1  
Reply Fri 21 Jan, 2005 07:40 am
Now if I told you that, where would be the fun in cracking the code? Let me tell you that you're certainly thinking on the right track. Twisted Evil
0 Replies
 
Bibliophile the BibleGuru
 
  1  
Reply Fri 21 Jan, 2005 07:45 am
Go on. Just a little hint would be nice.
0 Replies
 
DrewDad
 
  1  
Reply Fri 21 Jan, 2005 08:50 am
64 combos if you use triplets.

You should probably use one of your codes for the space, as the breaks in the sentence provide clues.
0 Replies
 
DrewDad
 
  1  
Reply Fri 21 Jan, 2005 08:50 am
Also, you may wish to cross-post to the Riddles forum.
0 Replies
 
Magus
 
  1  
Reply Fri 21 Jan, 2005 05:06 pm
How ribonucleic...
0 Replies
 
Wolf ODonnell
 
  1  
Reply Sat 22 Jan, 2005 01:06 pm
Ribonucleic? Embarrassed
0 Replies
 
markr
 
  1  
Reply Sat 22 Jan, 2005 02:19 pm
Four different nitrogen bases are found in DNA. They are adenine (A), cytosine (C), guanine (G) and thymine (T). In RNA, thymine is replaced by uracil (U).
0 Replies
 
Wolf ODonnell
 
  1  
Reply Mon 24 Jan, 2005 07:17 am
markr wrote:
Four different nitrogen bases are found in DNA. They are adenine (A), cytosine (C), guanine (G) and thymine (T). In RNA, thymine is replaced by uracil (U).


Yes, thank you, but I knew that already. My last post was just my way of indirectly saying that both DrewDad and Magus had figured out the basis for my code and that if they applied their knowledge of codons to the code, they would have cracked it.

All that meaning contained in the one word followed by a smiley. Very Happy
0 Replies
 
Bibliophile the BibleGuru
 
  1  
Reply Mon 24 Jan, 2005 10:32 am
Is the CODE now solved?
0 Replies
 
markr
 
  1  
Reply Mon 24 Jan, 2005 02:45 pm
Wolf_ODonnell wrote:
markr wrote:
Four different nitrogen bases are found in DNA. They are adenine (A), cytosine (C), guanine (G) and thymine (T). In RNA, thymine is replaced by uracil (U).


Yes, thank you, but I knew that already. My last post was just my way of indirectly saying that both DrewDad and Magus had figured out the basis for my code and that if they applied their knowledge of codons to the code, they would have cracked it.

All that meaning contained in the one word followed by a smiley. Very Happy

So, not only are you into cryptography, but you've got a helluva compression algorithm, too! Very Happy
0 Replies
 
Wolf ODonnell
 
  1  
Reply Mon 31 Jan, 2005 11:26 am
Bibliophile the BibleGuru wrote:
Is the CODE now solved?


ah, you guys have figured out the basis for the code, but you haven't actually figured out what the messages says now have you?
0 Replies
 
markr
 
  1  
Reply Wed 2 Feb, 2005 01:29 am
AUGGCCUAUUAAGAG
0 Replies
 
Wolf ODonnell
 
  1  
Reply Wed 2 Feb, 2005 01:19 pm
markr wrote:
AUGGCCUAUUAAGAG


Laughing

I see you've cracked it with that reply. Very well, I think I shall come up with a new code now to replace this one.
0 Replies
 
 

Related Topics

Lovatts - Question by margaret schwerin
1001 Ways to Call Someone "Stupid." - Discussion by DrewDad
Famous People Name Game - Discussion by Mame
Cities and Towns of USA - Discussion by Miller
Post about the one before you - Discussion by Green Army Sniper
Where am I - Travel Game II. - Discussion by Walter Hinteler
WHAT'S NEXT? - Discussion by Rod3
 
  1. Forums
  2. » Code
Copyright © 2025 MadLab, LLC :: Terms of Service :: Privacy Policy :: Page generated in 0.04 seconds on 07/05/2025 at 06:31:31